CShisMan2_77


Sequence

>CShisMan2_77 (16 EST) Length=628 GCACGAGATTTACATCTCCACAAGTAAAACGACTACGAAAGATAAAAAAAGAATGTACAAGGAGGAAAACACTATCGAAG TTCGTAAACTAAATGGTCAAGTAAACCTAGAGATTAGACGTCTCAACTCTATGTTTGCTCAGAAATTTCTATCTTGTAAA AACTCTCCAAGTATGGGGAAACTCTTTAAAGAACTTACAGGGGACAGGCAGATCAGAAGCAATAACCAGCTGAATGTTTG TGACTTAAATAAGTCTTTTGTATGTCAATCATCTGACGTCATACTCCCTATATCCACAGGTTTGAAGAATAATTGTGTTC CTAGTTTCACTGAAACTGATGTCCGAAAATGTTTCCTGTCACTTAATCCTTTCTAATGTTTAGGACCTATTGAAATCTTA AACCTCTGTCTTATAAAGTGTTCTGACGTTTCTATGTTATCTGTTCACGATCATCTTTAACAGATCCTCCTCAACTAATC TCATACCGAAAATGTGAACAAAGATAAAGATAACCTCAATACTTTAGAAAGTATCAGGCGATAAAAATGTGAAATTTAGA CCCATAGCAATGACTTCACCTTTCCTCAGAACAATGGAAAAATTAGTGGTACTCCCAATTCAACCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_77: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145823384942AI066975EST208640Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146933385053AI067086EST208756Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146973385057AI067090EST208760Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147663385126AI067159EST208830Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148643385224AI067257EST208931Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149653385325AI067358EST209036Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149673385327AI067360EST209038Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149703385330AI067363EST209041Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153493385709AI067742EST209425Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154183385778AI067811EST209495Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156273385987AI068020EST209709Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156323385992AI068025EST209714Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157723386132AI068165EST209856Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158553386215AI068248EST209939Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158783386238AI068271EST209962Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159283386288AI068321EST210012Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:35:57 on Tue 21 Nov 117.