CShisMan2_770


Sequence

>CShisMan2_770 (3 EST) Length=385 TGTCGAGGATATAAGTCTACAGTGTACTACATTCTTGAAGTAAGGATCAATGTCTGTCTGATATTGAGTATTTCATTCGC ATACTTAATGACTGGTTACAAGAGAGCCAAACTCGGTCAACTGAATAGATTGGTCACCTTGAAAAACAAAGTTACTACAC ACAAACGCAATATTTGTGATGCTGCATTCAAGCACATAAGTGATATACACTTTGCAAAGAAGCTAGAAAGTTTGCTGGGA CAGGCTACATGTACTTCGTATCCAGATCATCAGATAAAGTCGATTCTTTGCTCTCTTGATGTGATAAAGAACAATTACTT GCACAATGGACGTCTTTGCAACGAAGCATGTGAGGCTTCGGACGCCGTAATTCATCCTTATGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_770: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145813384941AI066974EST208639Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157623386122AI068155EST209846Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157943386154AI068187EST209878Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:9:13 on Tue 21 Nov 117.