CShisMan2_774


Sequence

>CShisMan2_774 (2 EST) Length=456 CAACAAGAACATTTCCGAATTGGNCCTCTGAAACNCCATCGCGGNAGAATAACATACGGGTAGGGAACCGACCATTTGTA TTCCGCAAAAAAAGCTGTAGGAGTTCCCTTAACGATCAGGCGCATGCCGTCAATGATCTCTCTTGCCGCCTTATTTCCTT TCACAGTTGTTGCTTGCTGACGAATTACAACTCCGTACCTCATAAGATCAGGCGAAACACTACCAAGAACCGCCGCAACC GACTTGCGGACTTGCTGAGTTTGAGCTGGATGAGTAACGTCTGCTCCAAAGACCATTATGAGCTCATCGCTGTTTTTGAT GAGATCTGGAATCTGCCAGTTGACACCACCAAGCTTCCCATTGATTTTTAGCAAAAGGTTTGGGAAGACGTTTGGTTTAT CGAGGGTGCGACTCCGTACACATTGTGTGCGAATGCCTATCTGGAGATCACTAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_774: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39315514709T14542SMEST0203Schistosoma mansoni, adult worm, Gloria Franco
5136961444949W06729SMEST0365Schistosoma mansoni, adult worm, Gloria Franco


Date: 12:47:19 on Sat 18 Nov 117.