CShisMan2_781


Sequence

>CShisMan2_781 (9 EST) Length=383 GATATGTATAAATAAATATATAATTAAATAAATATTGCATTATTGACAAGATGAAAAAAAAAGGAAAACACGCATCATAA TTCATTGGGTTCAATAAATTTTGTTTGTTTTAAACCAATAAAGACGAAGAAGGAGAAGATTCAAAATGTTTATCAAGAGA AAGAATTTGCAGGTTTTTTTTAAATAAAAAAGTACACTACTTTCCTTTCAAAAAGTGTTTATTTGTTTATTTTAAAATGT TTTGGATAGAGATAAGTGAACACCATGTGTGTGTGTGTATGTGTGTGATTTCTCATGATAACAATCAAATGTAACTATTG ACTAAAATGAAANTTAAGAATTAAAAGCAAAAAAATTTATTTTATTTTAGTAAAACAAAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_781: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099942330283AA559587MC080515.NA3TBRI-Saber-cercaria-A
12101312330420AA559724MC031093.NA3TBRI-Saber-cercaria-A
17368443189764AA999209MCCE0093.M1RSchistosoma mansoni, cercariae
17368973189817AA999262MCCE3059.M1FSchistosoma mansoni, cercariae
17370723189992AA999437MCCE3294.M1FSchistosoma mansoni, cercariae
17370733189993AA999438MCCE3295.M1FSchistosoma mansoni, cercariae
17371213190041AA999486MCCE3369.M1FSchistosoma mansoni, cercariae
17371553190075AA999520MCCE3430.M1FSchistosoma mansoni, cercariae
17371833190103AA999548MCCE3473.M1FSchistosoma mansoni, cercariae


Date: 14:41:11 on Sun 19 Nov 117.