CShisMan2_782


Sequence

>CShisMan2_782 (2 EST) Length=378 AAACGCCAGAATTTTTTCTTTACATTATTTGTTTAGCAAAATACCATCCAAACTTTGTTTGAAACCATTTCATTGCCTCT TCCTTTTGGACATGATGAATATTGCCGACGCGGCTTTGACAACGACGTCGGTATCTAACGCGCATCCCAGGTCTGCCCAA AATGACGTAGAAGTTCAATCCATAAATTCCAATAGCAGGATCATATTTTAGTCCCAGGTCAATATGTTCTGTCAGTCCAA AGCCGAAGTTTCCGGTTTTACTGAAGCATGATTTAGGAAGCTCGTATTCCTTCACCTTTAGACCCTTTTCCAAAATTTCT TCTGCTTTTGGACCCCGCACAGCCCTNTGAACAGCAATTTTCTCGTTACGTCTGATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_782: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344905975961R95591SMNHADA016021T3SmAW
7641901685506AA125687MLLG0252.M1FSchistosoma mansoni, lung stage


Date: 14:9:13 on Mon 20 Nov 117.