CShisMan2_784


Sequence

>CShisMan2_784 (3 EST) Length=387 TACCGAGGAACTGCGCTTTCTCGTTGCTCATACTGCTCCTTCGAGCGCTGGAATTAGGGATTTCATTTCACGTCACTATC TGTCTCTAAAATCTGCCAATCCTCATGTGAAGTTTATGATTCGTGAATCAGAAGGGATCACACCAAAAGTGTTTGCTCGT TATGAGATGGGGAAGGAAGACTATATTTCAGTGGCAAATAACACAGCTGATGATATAATTTCGAGACTGAAGACTCTAGA TCGAGTATAAATCGTTTTNTTGNGACAATTCTACGCAAATTAGNTTACAATTAATAACTTTCAGGATAAATAGCATGGTG GNGATTTTATTCANTNGTGTCAGCAAAAGAAATATTCANCTTGTTAAAATATANTCAATCTGGGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_784: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189961126883N21713SMNHADA00E003SKSmAW
4350851154109N33710SMNHADA020063SKSmAW
16451983056531AA917137SMTBCEA000081SKSchistosoma Lambda Zap II


Date: 12:39:35 on Fri 17 Nov 117.