CShisMan2_790


Sequence

>CShisMan2_790 (4 EST) Length=442 NAAATGGAAAATCAAGAATAAATAAGCAAACAGTGAAATGAGAAATACTCTCTTTTTTTGTCATGAATACTATCGAAAAG GTAGTAATAATAATAATAGTACTTGAGTATAATGGTACTCAATGACTTTTAATANATTCAATGTTAACTATAATCANTTA TTAATGTCATCATAATACTTTCCAATTATTACCAAACATCATTGTTANCAATCATGCAAAATGATTCGTATAGCAAAATT AAATAGCTCGTTATTGGNTTTTTGGAAGAGTAAANCAAAAGAANCAAGTAAAAAGGATCANTCAATTGTTTATTATGAAT AAATTCAGTAGGAAAGAGAAACTTCAATTCATCTACCATCATCATCATCATCTCGTGCCGACTCATGCACTGTTAAGNTA ATNATAATTNATATTGAATAAAAATATCTGTAANTGTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_790: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344806974663L47066SCMRAP153C2/SK adult worm mini-library
4190041126891N21721SMNHADA00E023SKSmAW
4192051128056N21923SMNHADA020015SKSmAW
4291951145921N28065EST000023S. mansoni cDNA


Date: 17:57:15 on Fri 17 Nov 117.