CShisMan2_798


Sequence

>CShisMan2_798 (2 EST) Length=380 AGGCGANGGAATATCGGTTATTTANACAGTATTTCATTAGACATATGCAAGACGAACAAGCAGTCAGAAGGATATTTGAA ACAGTAGACAGGAACAGGGNACGGAAATATTGATCACCAAGAGCTACAGCTGGCACTATCAAATGGTATAGGTACTCCCA TCAACTCTAGAACTGTCCAGCTGATGATTTCAATGTTTGACCAAGACAGGAATGGAACCATTGATTTGAGAGAGTTCGTC TATTTATTTAAATATGTCCAGGATTGGCAACGGTGTTTTCGTCAATATGATCAGGACAGATCTGGATTAATCGATGCTCG AGAGTTCCAAAGTGCATTGTCTTGGGNGGGTTATCGCCTCTCTCCTTCTTTNATAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_798: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350651154089N33690SMNHADA018052SKSmAW
11529362245771AA508331MAAD0406.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 15:1:35 on Fri 24 Nov 117.