CShisMan2_803


Sequence

>CShisMan2_803 (2 EST) Length=427 GGAAACGATTTCGATATCAGTATTACAATAAATCCGATGGTGCGATATGGCAGTCTATTGAGAAACTCGATCACCTCGGT TTAAATGCAATTCGAAGCCTGAAACCAAAATCATTCATAAAATATCTTGAAGAGTACAGCAACACTATATGCGGCAGGAG AAGTATAGGCGTGTTGTTATTTATGATTGACTGTATTCGACAGAAGCAACCATCTAACCTGGAACTTAAAATCTTAAATT ATACACAATCCAGCCACTGCCAGTCGATGGAAGATTCATCAGTGACGTACGCTGCATGTGCTCTAGTCAGCCGTGAGTAA ATATATAAAAGAATTCGTAAGAAAAAGTTTGTTATATATTTAAATAAAATTAATAATCCCTAAAAAAAAAAAAAAAAAAA AAACCTCCTCTTCCCGAAACTGACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_803: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137411444994W06774SMEST0410Schistosoma mansoni, adult worm, Gloria Franco
17609553237176AI021764ME0033.R1RSchistosoma mansoni, egg stage


Date: 21:52:32 on Sat 18 Nov 117.