CShisMan2_804


Sequence

>CShisMan2_804 (4 EST) Length=379 AATGCTTCTTAATCAGTTAGTGNAAATGCCTTATTGGACAGTCTTAGTTTCATCAATGATGCATCGGATCGGTTCATGTG ACTGTTTTTTCCTCCTTTTTTTACACACATCAATTACAGCTTACCCTATAAAATTGTACTGTAGTTATGTTTGGACTAAA TAATGATTTGTGCTGTATCAGTTTTTTTTATCCCTTATATTATTTTAGTGATGTGTCATTGTGTTGCTGATGCATTGATC AGTCTAAATGATCTTCTGTATGTTACTTGAATTGTCAATAGTTGTAAAACCCCTACTTTCTTTGTAAGCTTCAACCCTAA CATTATGGGAATTGTCTCTTTTAAAATGGATTAGTTGAATAATGAATNACGGTGGTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_804: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344883975939R95569SMNHADA008017SKSmAW
344890975946R95576SMNHADA008071SKSmAW
12100762330365AA559669MC180914.NA3TBRI-Saber-cercaria-A
16891823116551AA952845SMTBCEA000515SKSchistosoma Lambda Zap II cercariae


Date: 11:38:5 on Fri 24 Nov 117.