CShisMan2_806


Sequence

>CShisMan2_806 (18 EST) Length=682 NANCCCAATACTAATCTCCTTAACCANTGGATACGAGTAANTAAATNAANCTACCTCTCAAGCGAAATACTATAAAACTA ATCNAACCTGAAAGGATATTCATCAACCCTTTAAATAAAACCACTAAGCTATTCATCCCGCCAAATTTATCACATCCACT TATCTTCCAATAACCAACCACAAAACCAAATCCAACTATCAATCCAACTATATATACCACCGACAACAACATCGACTGAT AACAAAATAAGTCAGTATAACCAACCACCAACCTAAATAAATAGCTATAACCTAATACAGAACTTAATAAAGGTAAATAT AAACTAACTGAATAAAACCGACGAATCCTAATCACTTTTCTGACCCCTCCTCCATCAAAAAGAAAGAATAGTCGCAAACT ATAGACTACAGATAACNAAACACACAATATTATAACAATCACTAAACACACTTTAAATACTTTATACCCACCAATTCTAC TAATAAAAGCATGCTTACTAAAATATAAACAAATAAAAGGAAACCCAGAAAGACCAAACAATAAAGTGAATAAGTATATA AACTCACGTAAGCAACCTAAAAAACTCACCATTACCTGATTAACTTTTTGCCCACCAAAACCTCCAGAAATATAATTCAC CCAGCCAAAATCAAAAACTAAACACTTACTCAACCGGCACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_806: (18 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344842975898R95496EST000049S. mansoni cDNA
345036981303R95643SMNHADA020003SKSmAW
4071611119167H98282SMNHADA015083T3SmAW
4156401122583H98362SMNHADA015011T3SmAW
4179651125854N20682SMNHADA001005SKSmAW
4179681125857N20685SMNHADA001011SKSmAW
4180691125958N20786SMNHADA008080SKSmAW
4189791126866N21696SMNHADA009039SKSmAW
4191721128023N21890SMNHADA019048SKSmAW
4191841128035N21902SMNHADA019071SKSmAW
4191941128045N21912SMNHADA019090SKSmAW
4350921154116N33717SMNHADA020069SKSmAW
7808211705416N21765SMNHADA017095T3SmAW
12100082330297AA559601MC080530.NA3TBRI-Saber-cercaria-A
16716323098719AA938820SMTBADA000264SKSchistosoma Lambda Zap II
16891873116556AA952850SMTBCEA000521SKSchistosoma Lambda Zap II cercariae
17368893189809AA999254MCCE3051.M1FSchistosoma mansoni, cercariae
17371593190079AA999524MCCE3435.M1FSchistosoma mansoni, cercariae


Date: 10:45:58 on Tue 21 Nov 117.