CShisMan2_807


Sequence

>CShisMan2_807 (3 EST) Length=490 GTGAAATCCACCAGAAACAAAATGGAACAATGCATAAAACTCAACTATATTATGCACCAATAAATCAGATTCGTTATCTA CAATTATTACATTCAAAAGCTGAACAAATTATCACTTTCACATGTCGTAATACACCAGTATATTTTGATGTGAAAAATCA AAATTATAAAAATGCAGTAATTGTTAAATTATTTGATGAAAATGTAATTGATACTTATGAAGATAGACGCACACGCACTA TTGGTGGTGGTATTATGTTAGATATTAAAGTTAAAGATGAATGCATGGAACGAAGTAAACAAAAAGCCAGTAGTGTATTT GAATTTGTTGCCCGTAAACCAAACTTACTTCCATTAGTTGATATTCAATTAAAAGAATTCGGAGAAAGTGATCAAGAAAT TGGATATTATATGGATGCTGTTTGTTTTAGTTAAATTTGTCATCATTGATACTTATGATTTAATCAATAAATGAACTATT ATTTAAGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_807: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39265514659T14492SMEST0153Schistosoma mansoni, adult worm, Gloria Franco
5858751377936U58057SMU58057Schistosoma mansoni adult worm Lambda ZAP II library
18153053385665AI067698EST209381Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:16:59 on Sun 19 Nov 117.