CShisMan2_81


Sequence

>CShisMan2_81 (32 EST) Length=630 GTTCGTGACTTATATGTGAATAGTTGTGTATGCGAGTTTTAGATCCCATAGTATGGTGATTAGTTGGTTTTATATTTTTA TTTACGGTTGGTGGTGTCACAGGGGTGGCTTTATCTGCATCTGCTTTAGATATATTATTTCATGATACTTGGTTTGTTGT TGCTCATTTTCATTATGTTCTTTCTTTAGGTTCTTATAGAAGAATAGTGATAATGCTAATATGGTGATGGCCGTTTGTAG TTGGTTATAGTTTAAATAAGTATCTGTTACAAGGTCACTGGTTATTATCTATGGTTGGTTTTAATTTATGTTTTTTTCCT ATGCATTATTTAGGTATACATGGTCTTCCTCGTCGTGTAAGTTGTTATGATCAAGAATATTATTGGGTTAATGTTATAAG AAGAATTGGTGGAGTATTATCGGTTGTTAGAGGTTTTGTATTATTTTTTATTTTATGAGAGTCTTTGGTTGTTGGTAATC GTATAATAGGATTATGAGGTTCAGGTGGGTGCATTACGAAAGTGATGACTGTTCCTGTTCCCAGTCATGTTGATTATTTA AATGCTTCTAAGTTATGGGTAGTTAAGTAATGCTAAATAATCGTAGTAGTTAGGTAGCTATACAAGGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_81: (32 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344912975968R95598SMNHADA017016SKSmAW
344960976016R95531SMNHADA018076SKSmAW
345043981310R95650SMNHADA020033SKSmAW
345045981312R95652SMNHADA020043SKSmAW
345053981320R95660SMNHADA020083SKSmAW
3644381017365H63019EST000185S. mansoni cDNA
3879661065980H85666EST000408S. mansoni cDNA
4236391139740N25392EST000062S. mansoni cDNA
7823881713226AA143821MCCE0118.M1FSchistosoma mansoni, cercariae
7824271713265AA143860MCCE0103.M1FSchistosoma mansoni, cercariae
8248101769661AA185819MAAD0143.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248111769662AA185820MAAD0147.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248131769664AA185748MAAD0149.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248251769676AA185760MAAD0168.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248281769679AA185763MAAD0171.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248391769690AA185774MAAD0183.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248451769696AA185780MAAD0189.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248501769701AA185785MAAD0195.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529512245786AA508270MAAD0354.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529712245806AA508290MAAD0306.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12098502330139AA559443MC260430.NA3TBRI-Saber-cercaria-A
12099402330229AA559533MC070525.NA3TBRI-Saber-cercaria-A
12100062330295AA559599MC080528.NA3TBRI-Saber-cercaria-A
12102102330499AA559803MC250470.NA3TBRI-Saber-cercaria-A
16452183056551AA917157SMTBCEA000123SKSchistosoma Lambda Zap II
16629093080334AA931025SMTBADA000185SKSchistosoma Lambda Zap II
16891693116538AA952832SMTBCEA000415SKSchistosoma Lambda Zap II cercariae
17369093189829AA999274MCCE3075.M1FSchistosoma mansoni, cercariae
17371133190033AA999478MCCE3352.M1FSchistosoma mansoni, cercariae
17371173190037AA999482MCCE3357.M1FSchistosoma mansoni, cercariae
17372203190140AA999585MCCE3545.M1FSchistosoma mansoni, cercariae
17372673190187AA999632MCCE3645.M1FSchistosoma mansoni, cercariae


Date: 16:10:53 on Sat 18 Nov 117.