CShisMan2_816


Sequence

>CShisMan2_816 (5 EST) Length=515 NTTANNCACTNCATTTGGNTAGTGGTTACAATANATTTAAAAACTGTTTTTCTATAATTNGGNTAACTGTTGTCATCATC ANTAACTTTTCTCCGCCTGTTCACGAAGTTATCATTATCATCATCATCATCATCATCAAAAGTGTATGCGAGAGCAGCAG TGTTGTTATTATTGATTTTCCAATGGNCGAACAATTTTTATTTTGTAGCATTTTTTATCATACAAATTTATAGTTTACTT AGTAAACTAATTATTGTCCCAGTTACAATTTAATCATTGAACCATTCGCAATAAAGACATTAAGAGATCAGTCCACATTA AGAGATGTTGAATATTGATTAAAGAGTTTTTTTAAACAAATAAACATATACACCATCTTTTCTGTTTGTAGTTTTATATT ACTTATCATTTAAATTCATCGTTTGTGATTTATATAACGAAAATTGTTTTGTCTTTTTATTTTAAAAAGTTATGAATAAA AACGTTAAGAAACGAACCATGAAATTTAATCGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_816: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156431122586H98365SMNHADA015015T3SmAW
4190401126927N21757SMNHADA017065T3SmAW
5137301444983W06763SMEST0399Schistosoma mansoni, adult worm, Gloria Franco
17372273190147AA999592MCCE3552.M1FSchistosoma mansoni, cercariae
17372543190174AA999619MCCE3596.M1FSchistosoma mansoni, cercariae


Date: 17:4:11 on Wed 22 Nov 117.