CShisMan2_819


Sequence

>CShisMan2_819 (2 EST) Length=394 CGGCTCATCGTAATTTGATCAGGCTGGGACCTGACATGAGATGTAGAAGGAGGACGCCAGTTAGCACATTGGCAATGACT GTACTGGGCCAGAAACACGTTGTAGTCTGTGCAAAGTTGTAGTAGACGGTCACCGTTATCGGGCACAGTGATGATAAATG AATTAGTGTCACTATCTCGAAACATCGACTTCGGTGACCTAGAAATCAGCTCGCCTATGGTGATAATGCTGTCCTATCTA AACGATCTCNNAAAAGGTTTTAAACCTTTNGGNNACTGGTATAAACTAATGCTACCAGTGAGTACGAATCTGAAGCAGTC TTTCTGAAATCGCGTATGTCATTCAAGCTAGCCTTCATCGGTCGGTTCTTAGGAAAGCCNAAGGTACCCGGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_819: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826522160109L81246SCMRAP0366C2/S1 day seven schistosomula mini-library
11826542160111L81248SCMRAP0368C2/S1 day seven schistosomula mini-library


Date: 14:34:31 on Sun 19 Nov 117.