CShisMan2_82


Sequence

>CShisMan2_82 (7 EST) Length=766 ACTATCATGTACAATGCTCGTCCTCTTGAACTATGCGCAACATGTGGAGATGGTCCTGAACTAGGAATACCAGGGAAGTT GAAAGCATGTCAGCAATGCAAAATTACTTCCTACTGTTCAGTCTCTTGTCAACGTTTACACTGGTTTACACATAAGAAAT TTTGTCCAGTTATTAAAAAACATAAAAAAGAATTTGAATTTGCCAAGTGAAGCATAAATGACATTGCAATTTGTGATACA TACACTAACTTTTATTCCACTTTACAACGGATTTGTTGTTCATATTTAATTTAGAATAATTTCGTCGCCCTGAAGCATGG CTTCTCAAGATGACGAATTCGTTGTTCCTCATATGGATTTATCTTGTTTGCAAAATTCAATAGCATATCAGAAAGTTCTT GAAGAACCTTGGACTTACCTTCACAATTGGGATTCTCTAACTCCAAGTGTCCAACAAGAGGTGGCACAAAACTTCCTAAG TGAACTAAGCTCAGTTAAAACTGAAATGGCGATTACCCAAGGCGTATTTGATCCTTCCATGTTTGTTAATCAGGATGTTT CATGTGATACAGCAGCTTCTGGACAAAATGGTAATACAACAGAAAATCATGCAAACACCAAGTGATGTTTTGATTATTTA TATTTCCTACTGTTCTAAATAAAGTNTGCCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGACCGCCACCGC GATGGAGCTGCCAGCTCTTTGTCNGNTTCAGTGAGGGTAATCCNGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_82: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291841145910N28054EST000001S. mansoni cDNA
7791051702764AA140604MEEG0141.M1FSchistosoma mansoni, egg stage
18150523385412AI067445EST209127Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151193385479AI067512EST209194Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155383385898AI067931EST209619Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156303385990AI068023EST209712Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159383386298AI068331EST210022Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:0:32 on Wed 22 Nov 117.