CShisMan2_823


Sequence

>CShisMan2_823 (4 EST) Length=408 GATACTATTTTCCGGAGTTTCGAGTGGACGAAGATCTTGTATCATTTGCACAAGCTTGTAATGCCTTGCAAATGTAATCA GGATTCACTGCTTTAGCCAGTACATCCAAAGTTTTATTAAGGTAATTATTCACATATGCTTGGCAAGTGTTTTTTAGACT TTTCTGATGCNATAGACTGACATATTTGTTTCTGCTGCAATCATATAAATCTTTACCCAATAATCTTCTGAAAGAATGTA GTGAACTAAATTCATCCCTGCCAAACATGTATCACATTCAGCTATTGNTGAATTGTCATCTTTATTTTCCTTAGTAAGTA AATTAATTTTGTTTGATTCCGTTGAACAAATTACGCTCTGTACAACAAACACCAAAATGAAGATAGAATGAATCATGATA GAATGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_823: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879601065974H85660EST000341S. mansoni cDNA
12097962330085AA559389MC100402.NA3TBRI-Saber-cercaria-A
12101142330403AA559707MC031059.NA3TBRI-Saber-cercaria-A
12101982330487AA559791MC250450.NA3TBRI-Saber-cercaria-A


Date: 16:12:1 on Fri 17 Nov 117.