CShisMan2_824


Sequence

>CShisMan2_824 (3 EST) Length=455 ATATTGATGAAACAATGAAATATTTACATGAACAAGTTGGTAAAGATTTATCCAGATGTTTATTCAGAATGAATTAACAC AATCAACGTGACACGTGATTCACATCTCCAACTTTAAATGTATGAGATTAGAAAGATAGAAGACGATGGACGACGAAGAC GACGAAGAAAACGTCAATATCTAGTTGCTTTTCAACTTCATGTGCTTTCTAATTTTGTTTTCTTGTTGTTATCGTTGTTA GCTAACTTCTATTCAGTCTTCTTCTTTCATTGTTGTTCGTAGACATTAATTATGACTATCACTTTTTTTTATATCACTTC TAATATTACTACTATTCATACTAATATTAATTTATATTGGCGTTACTGTTATTCAAAGTGCAATCAATGCTATCAATGAT TGTGATTCTTCAAGTTGTTTTTTTTTTCTAAATTAAAATACAGTACATACAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_824: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533763228051AI014219MEEG0391.M1RSchistosoma mansoni, egg stage
17533813228056AI014224MEEG0605.M1RSchistosoma mansoni, egg stage
17654303241837AI026223MEEG0460.M1FSchistosoma mansoni, egg stage


Date: 6:31:19 on Thu 23 Nov 117.