CShisMan2_825


Sequence

>CShisMan2_825 (6 EST) Length=573 ATGTAGATGGTTGCTTGTTATTATCAGCTATCATGAAGATTCACATATCAAAATCAGACCCTGTTAAACAATCAGAATCG GTGTTTACAACATACATCAATTCAACAAATGCTAAAAGCATCAATTCCAGCGGCGAATGCATGAATTCCACCAGCAGAGA ATACAACCTCTTAAACTTGTGTTGGAAGCCGAATGGTTCTGAGGGCAATTGGAATATATCATTTAATTTCTCTGAGACCT ATCCTGGTTATTATGGTTTGACTAGCGTATACTTATTGTACTGGCTGGATAAATTGGGTCCACATAATGCTTCTACGGAT AAATCACTTTTTTCTTGTGCTATTGGTACATCATTTGTTTGTTTAAGTGAACAAACTAGATGAATTAAAAGATAAATTAT CAAATTCAACAAATATACGACTTACATTTAGTGAGTTTCAAGTTGAAGCATTTAGAAATAATGATATTTTCTAATATACA TTTACTGGACCAACTTCCTCTTGTGCTGCCGATTATGTACCGACTAAAGTTATTCCTATTGTTGTCGGTCGTTTATTGTG GTAGAAGCGGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_825: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364791644615AA098645SMTBADAMS0712SKS. mansoni cDNA
16891133116482AA952776SMTBADA000712SKSchistosoma Lambda Zap II
18146533385013AI067046EST208715Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149733385333AI067366EST209045Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153383385698AI067731EST209414Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154303385790AI067823EST209507Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:51:56 on Tue 21 Nov 117.