CShisMan2_83


Sequence

>CShisMan2_83 (7 EST) Length=624 GCACGAGATTAAAGTCTGTAACACTAAATAACAATTTAGTGTACACATTTTAAAACGATTTTTAACACAAAATAAACAAT TTTTTATTTCCACATTCCTAACTGAATAGAAAAATAAGTCGTTTGTCTAAAGAGTTTCATGGAATTAAATGCCTAAGTGG ATCGAAGTACTCGGATCACTTGAACATAAAGTTTGAGTATCTTTAAAATATCGCGATTTGACGGATGTTATTTGTTTTAC CCAATCGTCAGCATGACCAGAAGGGTCTTCTAAATAATATGTTTTATTTGGAACATGGATAAAAAATAATTTGTTACTTC TCAATTCAACAGTTAACGAATCGGACCATCCAACTTCTCCTTTAAGTGTCATATTTTCAACATCGATATAAAAGAGATGG GGTCCTTCCGTTAGTAAAAACATCCGCTTTCTTGCGAATAATCCTCGACGCTTAAACAATATACCTTGTTTTAAAATTAA ACGACCGCGAACGAAACGATTGAAAGGATTATGTTTTCCTTGTGCATTTAATAAACGAATACGATCATCTTCAGTTATTT GAGAGGGAGACAAACCGAGTTCACGCGACAAGTGATATTTCTCTGCTTCGTTAAAACCAACTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_83: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146233384983AI067016EST208684Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148103385170AI067203EST208877Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148413385201AI067234EST208908Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149133385273AI067306EST208984Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149333385293AI067326EST209004Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154373385797AI067830EST209514Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157913386151AI068184EST209875Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:10:37 on Fri 24 Nov 117.