CShisMan2_837


Sequence

>CShisMan2_837 (2 EST) Length=413 TTGGCCGTATACCTCCGCGGTGTACCGAGAGAGATATTGAGCGGTTCTTTAAGGGTTATGGACGATTAAGGGACATCGTT CTTAAGAATGGATATGGCTTCGTGGAGTTTGATAATGAAAAANATGCGGACGACGCCGTATATNACCTCCATGGAAGAGA CTTACGAGGTGAACGGTTGATCGTTGAGCATGCTCGCCTTCCTCCTGGCACTCGAGGCGGCACAGAAGAGCCGGTGGAGG TGGTGGCGGAGGTGGTGGTGGCAGTGGTCGCGATCGCAGGTACGGTCCGCCAACTAGGACGGAGTATCGTGTTATTGTTG AGAATCTCTCGTCGCGTGTAAGCTTGGCAGGATCTCAAAGATTTGATGCGTAAGGCTGGAGAAGTTACTTATGCGGACGC ACACAAGTCAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_837: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39239514633T14466SMEST0127Schistosoma mansoni, adult worm, Gloria Franco
39305514699T14532SMEST0193Schistosoma mansoni, adult worm, Gloria Franco


Date: 15:36:48 on Fri 24 Nov 117.