CShisMan2_841


Sequence

>CShisMan2_841 (2 EST) Length=318 AATGAATTTTAAACTTTNCAGGTNGAGTANATTATGATAATAAATTCATCGAATAAAATGCGTTTGGAACAAAGAAAACA TTCANGTTTAGTGTTGGAATTGGAAAAAATTTNATCAACCGATGATAAGAAAATTAACGTTGGCAAAGAAATATTTAGAC AACTTCTAATTAAAACTCCTAACTTCATGAAAATGTATAAACCACTCCAATCAGTCACTTGGCCTCAAGCATTGAATTCG GGTTTATCTCACTAAAATGGCTATATGTTATGTGGATANTNTCACGNAAATTTGNGAGGAATTCCCATGAAGCAGNGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_841: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156691122612H98391SMNHADA015068T3SmAW
7808161705411H98411SMNHADA016063T3SmAW


Date: 12:31:7 on Sun 19 Nov 117.