CShisMan2_842


Sequence

>CShisMan2_842 (2 EST) Length=555 AAGTAGTATTTATTGGTAAAGATTGAATTGTTTCCGAATTCCCATACATGTAACCAATACCACCAAATGGTAATAATAAT AAATCCAAGTATTTAGATAGTGTAATAAACCACAGATNCTGANAAGAAAATANAAATAAATATTTATTATGCTAGAGGTT GCTGTAATTATCAATCCCACTATTAACTCCGATGAGAAATGGAAATAGATAATTGGATTAATAAGCTAATTAATTTGCGG AATTTTCGACCTTCATTTACTCCGAATAAAATTTTCACGTAGTTGTGGCATTAAATGTTCACTAATTTNGATCTAAACGA CTTTNCCAACGTGTTTACTACTTTAATAACGCCCATCCTTTATTTGTAAAGTTCAATTCCACCAGCGAGGCTGTCAGGTA AATAGTTGTTATCAATTGTGACTCTGCAATCAGTACCCGTCTGCTTTCGATAGGCGGCAACACATTCTGGTAGNACATTT TGCGTTAAATCACGGTCAACTTGACGGCATTTGATAATAACTTCTGGTTCCAGTAACTGGAAAANCCCCTGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_842: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344909975965R95595SMNHADA016027T3SmAW
4191701128021N21888SMNHADA019045SKSmAW


Date: 1:16:10 on Mon 20 Nov 117.