CShisMan2_844


Sequence

>CShisMan2_844 (3 EST) Length=371 ATTTTGGATTTTATATACCATGTCTATATTTTTGCGGATTAAGCGTCCAAACACTGATTGTCCTAGTCAAATCTGTGAAG CACAAAATCTTATAAAACGTCCTAAATCTGACTTACAATCAATTCAATTTAAATATATCGGTAGCCAAACTTCAAATTCC TCATTAATTGGCAAAATCGACAAAGTATGCACTTCTGAAAAATTATGTAAGATTATATGCAATACCTCAGATGCTACTGT CGTTGGCGAAAATCAGACAGTCAAGTGCCAACTCTTCTTCCTGATTTCTTCCCCCGCTTTCATTAAAGTAAACAATTTAA AACGTCCTGCTATTACCACTGGAGTTTTTGATGATTTTAAAAACTTAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_844: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533923228067AI014235MEEG0618.M1RSchistosoma mansoni, egg stage
17609433237164AI021752ME0025.R1RSchistosoma mansoni, egg stage
17609443237165AI021753ME0035.R1RSchistosoma mansoni, egg stage


Date: 7:39:17 on Sat 18 Nov 117.