CShisMan2_848


Sequence

>CShisMan2_848 (2 EST) Length=556 CCAAAGAATACACGATTCTGTCTACGTTTATCTGAAGATGGAAGTGGAAAAGGAGCGGCGGCCATAGCAGCGTCATGTAC ACNACAAAATTAAATAATACACACACAAGAAACTATTGTTTACATTCAGTGCTTTCATCTGTTTTGTTGGCCTGATACAA TTCTCCGATAATTCAGAAAACTGGCCCTCTTTATTTAGTTTCTTGGCTATGATTAATTTACTATACTTCGGAACAATATA ATCTTAATATTGAAGGAAAGAAACATCATTATGAAATTAAAGAATCAAATATAAATCGACTGTTTTTTTTCTTATTAGAT TACATAATAAAGTTAGTTCCAATAACTTAGTTCTTTATATACACGGCATTTTTCTGTAACTTCCTATGACTTCTGTTATC TGGNTTTTATATCAATAAAGTATNCCNCATATATATATATATATATATATTGAGNACTTCTAGTCAGTCAGTGGCATCAA AGTCACAGAATCTTATAGATTATATAATTCTCTTTGGCTTTATTATGTAAGAGTCAATGAAACTATATACCTAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_848: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39376514770T14603SMEST0264Schistosoma mansoni, adult worm, Gloria Franco
18694293509830AI111142MF003G03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 23:54:34 on Sat 18 Nov 117.