CShisMan2_854


Sequence

>CShisMan2_854 (3 EST) Length=408 TCGAGAATGTTCGCAAACTTGAGGACCCAAATTAAAGAGTCAAAAGGAATAAACTGGATGGATTTGAAAAGACTAGTGAC TCTCCTTGAACATATGAAGGAACGTTTTGATGTACAAGAACCAGTTACAGAAATCGAACTCGAACCAATCCCTGAGAAGC CATCGTTCTCTCTTATTTCTGGTGATAAAGATGAATCCGATACAAGTGTGAACAGTTCATAAATAAATAATTTTTTTTTA AACCATCGCTANTATTACTATTTTTAATATCACAATATAATAGATTTCTTTTTCCATGAACTCGGTTGATAATAGTTTTC TTACTCTGCATAATTTTGATTGATATTATTTTTCGCATCTATTGATTTGATTTCTTTTCTAATAATAATATAAGTTTATT ATTAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_854: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39292514686T14519SMEST0180Schistosoma mansoni, adult worm, Gloria Franco
344920975976R95606SMNHADA017048SKSmAW
5137201444973W06753SMEST0389Schistosoma mansoni, adult worm, Gloria Franco


Date: 3:56:27 on Sat 18 Nov 117.