CShisMan2_858


Sequence

>CShisMan2_858 (3 EST) Length=382 ACTTGTCGGTCACGTTGACNATGCNCGGGCCCGGATCGATGATACAACTGCGTACGTGCATCGCCTTCGATCTTCGCATT GCGCCGCGGAGCGTCCGGCGGATAGCCGTGCTCGCCCTCGGTCGCGTTGAAGCGGAACCAGCAGGCCTTCTTGTTGGCGA GCCAGACGCGCCAGCGGATGTCGACGAGGGTGCCGGTATTGCCGCCGCCTTCGATGCGATCGCCGAGCTTGAGCGGCCGG CCTGCGGACTCCGATCGTCGTAGACGTAGATCTGGAAGCGGCCGCCTGGNCTTCACGCGTCCTTGCGCATCTTTGTAATG TGCGACATAGCGCGCGTTCACCGTCGGCGCCATAGACCGGGTTGCCGAGCGAATCGCATTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_858: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39164514558T14391SMEST0052Schistosoma mansoni, adult worm, Gloria Franco
17581323233311AI018975SMEST0615Schistosoma mansoni, adult worm, Gloria Franco
17581763233355AI019019SMEST0659Schistosoma mansoni, adult worm, Gloria Franco


Date: 23:6:47 on Wed 22 Nov 117.