CShisMan2_859


Sequence

>CShisMan2_859 (2 EST) Length=371 TCTATAGGGGTTTCCGATTATGTCCCACGTTGGCCTTCCATACTTTCGCCAAATTTGCCTTCCTTCCTTGGATTACTATG CACGTATCTGTTCTCCTTATCTCGGTGCCCTTGTGATACTCAATGTCGTGCCTTGTTACGCTCTTGATGGTCAATGGATT TTGGAAAGCGTTNTNGGATTTATGTCTTCCAGGCGTATTATTATCGCGTCCAAAGAGGAACATGGTTTTTACTGTTGNTC TTATCCTTGGTAGTAGTCTTTNGGGACTTAATCTACTTCTCGCAATTCTGTACTTATGTCTTCAGGCTAACTACAGTGGT GGTCTAGCGGAATTCCATTAGTCCAATAACTTCTGTTAATACCTGGAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_859: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344849975905R95503EST000061S. mansoni cDNA
4350201154044N33645SMNHADA008019SKSmAW


Date: 12:40:5 on Sun 19 Nov 117.