CShisMan2_862


Sequence

>CShisMan2_862 (10 EST) Length=461 AAAGAACTGAAATATTTTATTCTTAAATAACAGTCTACATAATAAGACAATAAACTAAATCAATTTAGTTCTCCAAAAGA CATTGAAGTGTTAATTTTATTAATTATTCTTATACTTTGGGATGGCGGAAGTTTTTCCCGGCATATTTTGCCGCTGTTCC TAACTCTTCTTCAATACGTAAAAGTTGGTTGTATTTGGCCAAACGATCAGAACGACATGGTGCACCCGTCTTTATCTGTC CAGTGCAAAGTCCAACAACTAGATCAGCAATGAAAGTATCTTCCGTTTCACCAGATCGATGCGAAACCATGACACCCCAA CCTGAGTCTTGTGCTAACTTGCAAGCTTCGATGGACTCGGCTAATGAACCTANCTGGTTTACTTTCAAAAGAAGACAATT GCAAGCCTTTGAAGCGATGGCCTGTTTAATGCGCTTTGGATTGGTAACAGTCAAAANGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_862: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39168514562T14395SMEST0056Schistosoma mansoni, adult worm, Gloria Franco
39406514800T14633SMEST0294Schistosoma mansoni, adult worm, Gloria Franco
5137061444959W06739SMEST0375Schistosoma mansoni, adult worm, Gloria Franco
5137361444989W06769SMEST0405Schistosoma mansoni, adult worm, Gloria Franco
11587212252898AA514094MA2MA106.AA3S. mansoni adult Lambda Zap
11587412252918AA514062MA2MA126.AA3S. mansoni adult Lambda Zap
12099492330238AA559542MC070538.NA3TBRI-Saber-cercaria-A
17369183189838AA999283MCCE3092.M1FSchistosoma mansoni, cercariae
17369363189856AA999301MCCE3113.M1FSchistosoma mansoni, cercariae
17653953241802AI026188MEEG0424.M1FSchistosoma mansoni, egg stage


Date: 23:13:1 on Fri 24 Nov 117.