CShisMan2_865


Sequence

>CShisMan2_865 (2 EST) Length=372 GCACGAGGGTTTCCAGAATGCTTAGCTGCTAAATTTATGTCAAAATTTGATCATGATAAAGATGGTAGAATTACCTTAGA CGAATTCATCAAAACACTTTTATACACGGATGATAGTGCTTTTTCATCAAAAGTCGAATAACCTGTGCGAAATCATTCAA GCGTGCATGTACTTGTATTCTATCCAGATAAGACAGAGAACTAGTTTTTGTCTACCTATACCGGCTTTGTCTTGATTTAT TGAGTTCAATTTATGTCATGAGTTTTAATTTATTTGAATCAGAAATAATTTGTGAACTTGTTAGAAATTTGTTTAATGAC ATATTTTTGTTAAGATAAATGTGATAAACGTCTTAAGAAATGATAGTTAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_865: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529202245755AA508315MAAD0428.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
15130332854313AA791358SMTBADA000856SKSchistosoma Lambda Zap II


Date: 23:17:1 on Fri 17 Nov 117.