CShisMan2_866


Sequence

>CShisMan2_866 (3 EST) Length=371 CTGACGCTGGGTAAAGTACTAAAGGGATATCGACAGTTTTGACAAACAGAAATTACGGCATGTTGAAACTGAAGAAAAAG TTGTATTGCCAAACAAAGAAGTTATTGAGAAGGAGAAAACTGAGAAACAGCTTCTACAAGAGATCGAAACACCACATTCT TTGAAACGTACTTCAACAAAAGAAAAGAACCCTCTTCCTACCAAGGAAGACATTGCTGCAGAAAAAGCTATCCACTGATC ACCGATAAATGTTTCGCACATGTAATATGCGCCTTTCCCGAATCAGAACGTCTTTATTCTTTGCAGTTTTTTTTATTCGA AGCTTTCTGCATTATCATCTTAATTAATATAATACTATAAATTTCTATACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_866: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824571713295AA143890MCCE0278.M1RSchistosoma mansoni, cercariae
12097772330066AA559370MU002004.NH3York-Harrop-lung-A
17371753190095AA999540MCCE3457.M1FSchistosoma mansoni, cercariae


Date: 1:57:50 on Sat 18 Nov 117.