CShisMan2_867


Sequence

>CShisMan2_867 (8 EST) Length=534 CCCATTAATAAACTAGAATCTACGATAAACTTAAACTACCATAAACATTAATAGTCCTATTAATATAAAGTAAATAACAT AAACTAGCAAACCTTTTATACCCCTTACTATAACACCTTTCCTATCTAATAATGAATTTATAACTAAACCCAATACCATT AATCCTAACAATCTACCCCCAAACAAAGTTATAACTGCTGATAAAATCAATACAAAATCCTGTCTTAATAGACTTATAAC GGCCACTACCACTTCTCCAAAAAACTGTAAAGTTGGAGGGAAACTCGATACACCCATAAACACCACGACACTTACTGCCT GAATGGAAATAACTGAACAAAATACAGTTGATAAAATTAACCATCTTCGAGACAATATGCACCTATAACCTCATCATATA AATATAAACATTGCACTTACAGAACACCCATGACCATAAAAATACAACAAACTAACTAAATCTGTACTGTACTCACCAAA AATCAATATTACAACCCTCACCACTATATGTAACAAACTCAAAACAGCCAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_867: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39260514654T14487SMEST0148Schistosoma mansoni, adult worm, Gloria Franco
39293514687T14520SMEST0181Schistosoma mansoni, adult worm, Gloria Franco
345056981323R95663SMNHADA020093SKSmAW
4071471119153H98268SMNHADA015026T3SmAW
4071531119159H98274SMNHADA015052T3SmAW
4180701125959N20787SMNHADA008081SKSmAW
12099662330255AA559559MC070563.NA3TBRI-Saber-cercaria-A
12100382330327AA559631MC090723.NA3TBRI-Saber-cercaria-A


Date: 12:5:33 on Thu 23 Nov 117.