CShisMan2_87


Sequence

>CShisMan2_87 (11 EST) Length=671 GGTTCGTGGAGCATTACTTGAAATTGTTGGTCTTCCAGAAGCCACGAAAAAAAATGATTCAGTTGAAGGGGAAGATGCTA CAACTGAAGAATCAAAAGAGTCGTCAGTGAATGGCGGTAAAGACTCAGAAGTACCAACAGTTATGAACTTGAAACAGTGG TTAAACGAGAAGCTTGACTCAAGTACTCCTGTGGGATGGATTGATGTCGAACCATCTGAGGGGAAAGCTATAATACGATT CAAGCAACCTGATACAGCAGAAAAAGCATGGGCTAAATTAAAAGAAGCATTTGGCGATAGTCCTGTTACTTATTTAAACA GTGAATTATCAGGTCGCGTAATTACTGGTGACGAAGAAAAGAACCAGTGGAAAGTGATCCTTGCAGCTCAGCAACAGAAG GCTCAAAAACGACGTGGAGGACGTAGTGATGGAAGACAAATTCGTAACAAGCGACGTCGTACGAACTAAGTAAAATGGAA CAGATTGAACTCCATTTACTACTTTATTACTGTATATTCATCAAAACTAAACTTTCCTTTGAAATATTTCATTTCATACA AAATAAGAGAAGCTATGTAAAAAAGCAATCATTTGTCATGGAAAATATATGTATTTGGTTTAAGAAAAAAAAAAAAAAAA AAAAAAAAAACATGCCATGCAGCTGCATTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_87: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147403385100AI067133EST208804Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147643385124AI067157EST208828Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150273385387AI067420EST209102Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150943385454AI067487EST209169Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151183385478AI067511EST209193Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152153385575AI067608EST209290Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152203385580AI067613EST209295Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154973385857AI067890EST209577Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155563385916AI067949EST209637Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158993386259AI068292EST209983Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159323386292AI068325EST210016Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:34:9 on Mon 20 Nov 117.