CShisMan2_871


Sequence

>CShisMan2_871 (2 EST) Length=390 TTTGCCANTACCTTTTCATTCTTTAAACCAAGCATCNGCANGACGTTTGGCNTTTCGCNANTCANGATTCTTCCTTGGGC TCTGAACTTTAGTGATAGCATCCCGATGTATCTTTAGGATATTCAATTGACCAAAGCTGTATATTGCTTCTTGAACTTAT CTACCAGTCCCTGGGATTGCGACAACATGGGCATAGTGTTCCCAATTAATTGGTGGCAAAGATTCTGGAAGCGATGTTAT CCCTTGATACAAGATTGTCTGACTTTGTCTTTAACTCCCTGAATTGATCTAATTGATGTTTCGGGCATTTAGAATACAGT TCAGACCAATTCACAGCTGAAACCACAACCCGCTTAGAGGTCATCGCTAGAAATAAAAACCCCACTCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_871: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097892330078AA559382MC260314.NA3TBRI-Saber-cercaria-A
12098962330185AA559489MC270410.NA3TBRI-Saber-cercaria-A


Date: 5:5:17 on Tue 21 Nov 117.