CShisMan2_876


Sequence

>CShisMan2_876 (2 EST) Length=387 GCACGAGGATCAAACGACTTGAAGAATCACGTTCATGTTCATCTTCTAAATACTTCTATCGATTGCAACAACAACAGTTA CATGAATTAAAGAAGCATTTAGAAGATGAACATGAACGTGAAAAGAAGGAGATCAAACGACTTGAAGAATCACTCAAAAG AAGAAAAAAATTACTGGATGATCTTGAGAAGAAGCATTAAATTGAACAGGAATCCGGAAAAGANAAATGAACCATTTTCA TTAGGGCTTGGTATTTAGATATTATAGGATTGGAAATTCTAATTAGCAATGATATGTATCTATGTATTTGGTGTATATGT AGGATTTAACGGGATTTATGGTATTCNAAAAAGTTAAAATGATGATAAATTACTGGAATAATCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_876: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191791128030N21897SMNHADA019058SKSmAW
11529622245797AA508281MAAD0324.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 21:5:35 on Sun 19 Nov 117.