CShisMan2_877


Sequence

>CShisMan2_877 (2 EST) Length=370 GAAACAAACAAATACACCATTGGTCAGCTTCCTGGATAATAACAACAGCCAAGAGCAAGCGAATGAGGGCAACACTGACC ACATACAGAATATGGGGTGGGTGGCGACTAGATCCAAAACACTCCTCAAAGCCATCATTTGGATGCTACAAAGCCACAGG GGACTTTCAAAGCGACACGGATGGCAAACATTCATTAATATCATGAACATATAAGCTAACTGTACATTTGGGATATAATA CAGGGGAACGGGGAGTTCTGGTTAGGGTTAATTATAATAACACACAGTACTAAACATTTGAAAAAACAAATCCCAACTGA AAAGGACAGATGGGAAAAATTAACCTACACAGCATATCACGAGTGGGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_877: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18154603385820AI067853EST209537Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156763386036AI068069EST209758Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:11:41 on Wed 22 Nov 117.