CShisMan2_878


Sequence

>CShisMan2_878 (2 EST) Length=431 CGGCACGAGGTTCAATTGAAAAATTTCTATTTAGAAATGAATTTCTTGACACTTTACGTAACTTTGGTATATACAATTCT TAGCGTTTACTCAGACATTGAACCACGTATACAAAAGGAATATTCGGCACGAGATTACAATTTACATGAAAATAATAGTC AAGCCAACCACAACAAGTTTCATGAGATGCCTGAATACGATGACCAACTTCCCGATTTTCCACACAAGCAATTAGAAGAA GAGCAGAATCCGTTTCACAAACTTTCCGAAGTTCTCAATTCTGGATCTGTCGTACCACTGTGGTTGGTGAACCCAATATA CTATGTGTTAGAATTGTTTCCAAGAGCTATATCATATTACTTCAATTAAATGCAAGCTGACGAAAATATGTTGAATGATA TCATATGATACATATTGACCAATTTAAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_878: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13272162546880AA629472MU000102.Y2RSmL
13277812552118AA629507MU000112.Y2RSmL


Date: 1:10:22 on Mon 20 Nov 117.