CShisMan2_880


Sequence

>CShisMan2_880 (2 EST) Length=367 TACACAAAGGTTCAGAAAGCACCTGTTGTAGTTTCAATTGATTCCGCAACTCAAGGGAAATTCCAAGTTTCGGGTGTTTG GGGAAACGAGATAGAAGGTTTGGAACTTGATCTTGGAAACCAGATCAGTCAAACAGTACTTGGAACCTTACATTTCGATT CGCGAAGTCTGAAAATAGTTACAACCTCAGTGAAATTAGCTTCGTTTATGAACTGCTTGATTTGCCGGGTTTAAGATATG CAGCAAATAACCATTCACTATTTTCCGCTGCAATCGGTTCATACTATTCTTGTCAAGCTGAACAGGATTTAGTTTTAAAT CAATTCGCAACAAATCCTGTAACTGGNAACCTAACTTTCTCTCAGNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_880: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180111125900N20728SMNHADA007025SKSmAW
12165732338822AA566190MA3MR064.AA3S. mansoni adult Lambda Zap


Date: 18:56:14 on Thu 23 Nov 117.