CShisMan2_881


Sequence

>CShisMan2_881 (2 EST) Length=367 GTCCATNTGAGCCTCATTACACTAAGATAGAGNAATTTNGATATTTCACCAAATCGTCAAATCAAAGTACCTATGATGAT GAAAGAAGAAGTATTGCATTATGGAAAATTCGAAAATCAAGGATTTGAAATCGTCAGTAAACCATTAAATAACACACGTT TCACATTTGTTGTCGTATTACCTCTTGAAAAATGGTCTCTAACGGGGGCCATGGAACTTTTGAATGGGAATAAAATTCTA AGTGAATACATAAAGAAATTAAAAGAAACTACAGNATCATTAAGATTACCAAAATTTACATGGACAACTACACTTGATCT TGTGCAAACATCGACATCTATGGGTATTGNCGATTTGTCTACTCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_881: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343537973941R95211SMNHADA002006SKSmAW
11587652252942AA514086MC2NE018.ACSS. mansoni cercarial Lambda Zap


Date: 10:35:16 on Sat 18 Nov 117.