CShisMan2_889


Sequence

>CShisMan2_889 (2 EST) Length=367 TTCCTTCATCTTACGTGAGAGCGATCAGTCTGAAAATGAGATATATCAAGATGCTGATCATGCTGTTTGCAGTGCACCTT ACAATCATTCAGTTCGGTGGAGTCAGTTGCCGATACCGAGNAACTCAAAGGAACCCTACTGTCACCGAAGTCAAATTGGG TGATGAACCAGATTGGAACCAAATTCCAATTGGTGTCGAAGTTGACGATCATCGCCCCAATCCAGATGATCCTCGTTTAA TTCCTCCACCTCCCGAAATTGACGGTGGATTTTCCGAATCCCGATAACTACTAGTCATCTGGGTGAAAATGAGGATGGTG TCTGATGGAAAATTGATTTCAGCACATCAATATCTCAGTAGATGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_889: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180401125929N20757SMNHADA008015SKSmAW
4350291154053N33654SMNHADA008088SKSmAW


Date: 6:54:34 on Sat 25 Nov 117.