CShisMan2_890


Sequence

>CShisMan2_890 (7 EST) Length=365 GGAAATTCCTTAAAGACTACTGGTGGCTTTAAAATTACATGCTATTATATTAAGATTTCACAATCGTATATAGATTATGT GGCTTTTCACATAGAAAACACCAGTACATGTGTGAAAACGCTCAAATTGAATCACAAAAATCTAATATCTGTGGACACAG TGGTTCTTGTAACTTGTGCTCGAAAGAAATGCATCGACAAATCATATTTTAAACGAAAGTACTTAAAAAATAAAACGAGA CGTTTCCAGTGACCATTAATTAGTATTTGTTGAAGTCTTTTTTATGGCATCTTTCATTTTGCTTTGTGGTAAAATATTAA CGTTAACAGATAGATGACAAGAACTACAGAGAGAAAAGAGTAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_890: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149103385270AI067303EST208981Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149173385277AI067310EST208988Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150803385440AI067473EST209155Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152413385601AI067634EST209317Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154503385810AI067843EST209527Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156263385986AI068019EST209708Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159183386278AI068311EST210002Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:12:17 on Fri 24 Nov 117.