CShisMan2_893


Sequence

>CShisMan2_893 (6 EST) Length=954 CTGAACAAACGCTTTCATTTATTAATTTGAATTATCACAGAAATACATTGCCCTTATTCAGGGTAGGCGATAGTTTGGCG ATTTGAAATTTTAAGTAAAAAATATGAAACCCAATTCATTGAAAACAAGCCAAGCTAACAATAATTGCATAGGGGAANCT TTTAAAAATTGTTCCAAGTATCCAAAGATTTTTTACAAGACGGAAATACACTGCATCGGATTTACCGAAACGAAACTGTA GCACTTAAGTCACAATCCAGTAAATATTCATTTTCAAAAACATGGAAAATGATGATCCAAGCAAACACAAACCACCAGTG CTATAAGTTGGGTGGTAACAGTACTAAACCTTAAATCGAATCAGATAAAACCCTACAGACGAAAATGAATAGTCCANAAA TGGAANCAAGCCAAAGGTTANATACATGGGCAATATTTATTGGTGTATCAATCAAATACATCAGAAGAACGATGTATTAC ATCGTACGCAAAGTTAATTAGTAATTATATTTCTTGTAATAATCGCAAATACAGCTCATTGCATGATTCCCTGGATTGCA ATTATTTAGATTATCGTCGATAGTCTGTCCAACCAAGCAAAGTTTTGGTGTCATATGAAATATAATTGACTTCTTGAGAC ATCTGCTGATAAAACTAGTCGGCTCGCGTCTTATGATGATATACTTTTCATTCATGAACGTAAAAGAGGTTTCCCTTGTT ATCATTGAGCNNGTGATTTGAGCTGAAGCACAAACTCGGGAGATAGTTGGAAATCAGGACTAGATGAGCCGTATGGAGTT ACCCTGGTGATCTGTTATGGGTAAATGTTTCAAGCTTTTGTGTTCATATACATGGTTCTCACACCGTTTTTTCCACTCTT CGGACATTGTTCAATTAAAATAGACGGATACGCCAAGAAAATACTGTACCACCAAACAGAAAGACCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_893: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156791122622H98401SMNHADA016029T3SmAW
4191881128039N21906SMNHADA019077SKSmAW
7823941713232AA143827MCCE0128.M1FSchistosoma mansoni, cercariae
12098472330136AA559440MC260424.NA3TBRI-Saber-cercaria-A
12101492330438AA559742MC140313.NA3TBRI-Saber-cercaria-A
17369753189895AA999340MCCE3164.M1FSchistosoma mansoni, cercariae


Date: 8:47:19 on Fri 24 Nov 117.