CShisMan2_894


Sequence

>CShisMan2_894 (5 EST) Length=407 AGGTTTAATTCAAATATTTATTATTATTATAATCATTATTGTCAAATCAAAACATATTTCGGTAATTACAAACGAAAAGA AAATGTTCTAAAGAATACTGTTTTCAAATGGTTACTCGTCTTCTCAGTTATATTGAATACCGGCATACTGCAGTTGCAAT CAGAACAGAACCTATTACGGTGTAATATGCTCCTGTCATCGTAGCACCAGATACCGATGCCTTAGGTGTAGGCGGTTTTG GCTTCGGTGTAGTTGATGTGGGCGGTTTACTTTCCTCACCAAATAAGCTTGAAGCTTTTGTATATTGAATATGATGACTA AATGATAAGATGATAGCAAAGATACAAATGAATCTCGAAGTAATAATGTTNCATATTNCTATGAGTATGTACGTGTGTGT GCGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_894: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824561713294AA143889MCCE0277.M1RSchistosoma mansoni, cercariae
12098172330106AA559410MC250422.NA3TBRI-Saber-cercaria-A
12101622330451AA559755MC140335.NA3TBRI-Saber-cercaria-A
17368963189816AA999261MCCE3058.M1FSchistosoma mansoni, cercariae
17371673190087AA999532MCCE3447.M1FSchistosoma mansoni, cercariae


Date: 3:54:58 on Sun 19 Nov 117.