CShisMan2_899


Sequence

>CShisMan2_899 (2 EST) Length=305 CGAGGTCTGTTAGCTTTATTAATAGTAGCATTTTTTTTTACTTTAATCATAGGATCTATAACATTTTATGTTTTAGGATT TAAATTTCCACTAAATCACTATATTAAACTTAAGGAATTGGTATATTAAATTTGAAGTGCGGGTTCCTAAGGCATGGTTA CAAAAAAAATTTTTTTAGGTTTCCTTACTTAAATTTATTAGTATTATTTGTGGTATCCGATTTGGAAGTTCCTTTATTGC TAAAAGTCGTATTTGATGGGATTTGATTTTATACATATTGATGTTATTTCTTTTTTTNCTTTTNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_899: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099382330227AA559531MC070522.NA3TBRI-Saber-cercaria-A
13277512552088AA629477MU000023.Y2RSmL


Date: 21:24:59 on Sun 19 Nov 117.