CShisMan2_9


Sequence

>CShisMan2_9 (4 EST) Length=690 GCACGAGGACCGCATCATGTTAAAAGTATGGGTTGGTCGATTTTTATGGTAAAATAATAAATAGGTCAAGTTGTCTAGAG TTTCCTCGTTATCAAGAAAGTACAATTGGCTATTGGCAGTATAAATATATCCAAGACTAAAGAAATCAAAGCCATAGAGT TAATATTTTCTTCAGATCCACACTATATAAATGCACATCTTATTTCTCAGACTTTGTAACTGATAACTCAGCCCCCTATT TCTGGTGGTATAACTTGAGCACATTTTAGCAATCTTGTAGATTTTCTCACTTTTGAAGCTAAACCTTCCTGCTGTACAGT ATTGTTTTAATTATTATTCATTCATACTGTAGTTAGCCTCTAGGTCGTAAAACTGATTTCCATTTGTAATTTCTTCATTC TGGCGTTTGATAAGAGAATTATGCTTTTCTGTAACCCTCTGATCATGTAATTCTCGAAGTCAACTCAGTTGCATCTGACT AGTCTCTGTACTTTTGAAAAAGTAGTAGTATTTGACTAGATTTTATAGTTCTATTTTTCAATGGAATAGAAGTTAAAAAA GTGTTCGCATCAACATACCAAACCTTAGTTTTGATTAAGATACTGGGATGGTGCTCAGAGTTATGANACAATTAGACTTT ATATACATAGTTCCTTTTATTATCATATAAAGAGATCTCTCTAACAACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_9: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152493385609AI067642EST209325Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154963385856AI067889EST209576Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156233385983AI068016EST209705Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157283386088AI068121EST209811Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:14:59 on Fri 17 Nov 117.