CShisMan2_90


Sequence

>CShisMan2_90 (18 EST) Length=621 GGTTACGCAGTACGGTAATGCAGCTGCATGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGAATGAATAGGTTTTA TTCATCTCGAATTCAAACACGACTATATTACAGTGAGTTGAATTGAGAGGTGTGTAGAAAAATAGGACAGTGGAGAGTGT GACACAAACAAATTAGAATGATCCACAACTCAACTGGTGCCTCAGTAACCGCCTCCATAATGGCTGGGTTTGTAAGTGCC ACCTTTGCCGCCTTTGCCACCTTTGCCACCACCCTTACCCTTACCGCTACCACCGCCATAACCCTTTCCATAATTGTTGC CTTTACTACCACCTTTTCCAAAGCCGTTGCCACCGTTACCATAATCACCGCCATAGGGGGCAGGGAAGGCCTCATCGAAG CCACCTCCACAATTGCCACCACTGCAACCACCACCATTCCCACCACCATAGCCACCACCGTAATTACCACAATCTCCACC ACTGCAATCACCACCATAGCCACCACCGTAATTACCACAATCTCCACCACTGTAACCTCCACCATAGCCGCCGCCACAGT CACCACCAGTACAGCCTCCACCATATCCACTATCGCCATAACCGCTATCAAAATCGCCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_90: (18 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344904975960R95590SMNHADA016019T3SmAW
344946976002R95517SMNHADA018031SKSmAW
4071651119171H98286SMNHADA015088T3SmAW
5858991377960U58081SMU58081Schistosoma mansoni adult worm Lambda ZAP II library
8578221832582AA218489MAAD0156R.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578431832603AA218510MAAD0185.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578531832613AA218520MAAD0208.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
9103131907431AA269310MS1MM024.AS6S. mansoni sporocyst Lambda gt11
11529242245759AA508319MAAD0424.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11587542252931AA514075MA2MM032.AA3S. mansoni adult Lambda Zap
14785862804082AA756912MF4MA154.AF3S. mansoni female adult Lambda Zap
14786022804098AA756928MF4MA170.AF3S. mansoni female adult Lambda Zap
15233892870791AA801619SMTBADA000858SKSchistosoma Lambda Zap II
18151653385525AI067558EST209240Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151833385543AI067576EST209258Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151873385547AI067580EST209262Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151973385557AI067590EST209272Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152033385563AI067596EST209278Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:23:2 on Mon 20 Nov 117.