CShisMan2_900


Sequence

>CShisMan2_900 (3 EST) Length=364 CCCAGTGCACGTAGGGTGCTTAAAACGTAACGCTATAGGGATCATCTTTGGTTAATATGGGTGGAGTTTTTTCAAATTTG TNCAGCCGTCTGTTCGGCAAGAAGGAAGTTCGTATCCTGATGGTTGGCCTGGATGCTGCAGGCAAGACAACAATATTGTA CAGGTTAAAACTTGGGGAAGTTGTTACNACTATCCCTACAATTGGATTCAATGTTGAGACAGTGGAATATAGAAACATTA GTTTTACGGTGTGGGATGTCGGTGGACAANATAAAATACGTCCTTTATGGAAACATTATTTCCAAAACNCTCAAGGTTTA ATATTCGTGGGTTGACANTAATGACCCTGATCGCNTTGGGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_900: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879621065976H85662EST000344S. mansoni cDNA
18695453509946AI110976MF002E04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696093510010AI111040MF001G08.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 10:6:51 on Wed 22 Nov 117.