CShisMan2_911


Sequence

>CShisMan2_911 (3 EST) Length=460 CTTATTTCTAGTTGGTCGGTGGCCCNGCTTNGTTTGCGTCAGCTGTTTACATTAGATTTTACNAATTAACTGTTACACGA CCTAATAAATATCTTTGTCCAATGTCTCAATGTTCACCACTCATTAAAAATATGTCATGGGGTTCCATTACAGTGGAAAC AATATCTGAAGATGCACACAATCAATCCAAACAAGTTAATTACATACCGAGATGCAAAACTTTGGCCAAATGGTAGTCGT GCATGGGATTGGAACGAATCTGGCACTGGTCATTTTGCAGGGATTCAGAAACAGGATGTTGATGNAATTACTCAGTTATA AACCAAATATTATTATACTGAGTAAAGGAGTACTATCTCAGGTGGAAAGTGTCCCAATCAATTAATTGGATTACAATAAA TCAAATCGGATTCCACATATTAAANGGTAATGGGAGGAGACAAGTAAAAAAGGATTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_911: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191251127976N21843SMNHADA018061SKSmAW
4191261127977N21844SMNHADA018062SKSmAW
4236311139732N25384EST000535S. mansoni cDNA


Date: 17:49:36 on Fri 17 Nov 117.