CShisMan2_915


Sequence

>CShisMan2_915 (2 EST) Length=362 CGGCACGAGTCAAAACAATTTATTTCATATTAGAAAATGCTCCATTACAATTTCTTATGTGTGGTTTATTACAGATTGGA TTAAGATTTAGCTATTCTTCTACAATGTTTGTGTTATAGAGGTGAAGGATTTACGTGATGTCAATGTTACAATTGATCGA GTCAACATGGATAGCGAAGACAGTGATGATAATGATGTCAATTTGTATGTGATTGTGAATAGTAATAATTACTTTTCTTG TTTAGCTTATCTGGAATATTTATTATTTTGTACTTCCGTTGTAGGGAGATCTTTCCTATGCCCATCAGTTTCACGTACCA ATNTTCTCTTTATTTTCAGATCTCNTTTAGGTGACCTTGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_915: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350230988861H49020EST000075S. mansoni cDNA
4190111126898N21728SMNHADA00E035SKSmAW


Date: 9:32:49 on Sun 19 Nov 117.