CShisMan2_916


Sequence

>CShisMan2_916 (3 EST) Length=381 GAAGAAACTGATTCTCAACTGATAGAGGATGACGGATCACATCATCGTGGGAGCCAGTTTGGTAACAGGCTTGGNTCTGG AAAAAATGATTCATCCACTGGTGAAAGACGGTCACATAGGCGTCGCAGAAAGCATAACCGACAATGTGAACAAACAGGCC ACTGTCCTGAAGGTGGTGCTAATTGGAGACGGTCACATAGACGTGGGAAAAAACATCGTACACGATGCAGTGCTGATGGT GATTGTNCTGAAGGTCAAATGTGTAAGGAACGTCGTCACGGAAGAGGACGTAAACATCAAAATGGTGGTACTCTGCGTAG CTTCCGGCAATTCATCTCCATCCTCTCATAGTGGACCAAAGTTGGAAAGAATTGTCCGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_916: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350220988851H49010EST000105S. mansoni cDNA
12165392338788AA566156MA3AS042.AASS. mansoni adult Lambda Zap
15417732889785AA819942MF5MA189.AM3S. mansoni female adult Lambda Zap


Date: 17:52:46 on Mon 20 Nov 117.